0
Want this question answered?
Be notified when an answer is posted
Add your answer:
Earn +20 pts
How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
To replicate the DNA sequence provided (ttcgagacttagtcggatgtgaagtgg tgatt), you would need to use a DNA polymerase enzyme and a primer with a complementary sequence to start the replication process. The primer will bind to the target sequence and direct the addition of nucleotides to form a new DNA strand that is complementary to the original sequence. The result will be two identical DNA strands with the same sequence as the original.
What is the amino acid for t a c g c g c c t a g g g g g t g g?
A t g t g g a a c c g t g
What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?
The DNA sequence provided is: TTCGAGACTTAGTCGGATGTGAAGTGGTGTATT To replicate this DNA sequence, the double-stranded DNA unwinds, and new DNA strands are synthesized using the original strands as templates. Adenine pairs with thymine and cytosine pairs with guanine, following the base pairing rules. This results in two identical DNA molecules, each containing one original strand and one newly synthesized strand.
What is a complementary sequence for to DNA strand A A T T C G C C G G T A T T A G A C G T T?
It's GTTCATCCGA
What is a complementary DNA strand using a t t g c c a g c?
The complementary DNA strand to "ttgccagc" is "aaggctcg". In complementary base pairing, thymine (T) pairs with adenine (A) and guanine (G) pairs with cytosine (C).
What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?
The complementary DNA strand to the given sequence would be t c c g a g t c a g a t c g. This follows the base pairing rules where adenine pairs with thymine and guanine pairs with cytosine.
Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?
B. G-G-A-T-G-C is the complement strand to C-C-A-T-C-G. The complementary base pairs are as follows: C-G, C-G, A-T, T-A, C-G, G-C.
What is the DNA code for A-T-C-G-A?
C-G-A-T-T-A-G-G-C
What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A
What is the name given to the process where the DNA is copied?
The process where DNA is copied is called DNA replication. During DNA replication, the double-stranded DNA molecule is unwound and each strand serves as a template for the synthesis of a new complementary strand. This process is essential for cell division and passing genetic information to offspring.
What is the complementary strand for this sequence for c-g-t-g-a-g-a-c-c-t-g-g-c-a-c-t-a-a?
G-A-T-T-A-G-C-C-T-A-A-G-G-T-C-GDNA base-pairing rulesAdenine - ThymineCytosine - GuanineRNA base-pairing rulesAdenine - UracilCytosine - Guanine
What is the complementary DNA strand for t-a-c c-g-g a-t-g c-c-a g-a-t c-a-a a-t-c?
The complementary DNA strand for the given sequence is A-T-G G-C-C T-A-C G-G-T C-T-A G-T-T T-A-G. Remember that A pairs with T and C pairs with G in DNA strands.
