A framed set of round wooden rungs hung on a wall goes by the name of gynamistic wall bars or stahl bars and is used in gynamistic stretching and training exercises. I was looking to purchase one as it has many possible uses as a prop for yoga practice.
ladder.
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
orbitrac‬‏ :)
A crucible.
It is a horizontal line of ladder logic.Ladder logic is a language used to program PLC's.It's called Ladder Logic because the programs are formed in the shape of a ladder. Each horizontal line in the program looks like the "rung" of a ladder, which is why they call it Ladder Logic.
Like a human hand
DNA has a double helix structure, resembling a twisted ladder. The sides of the ladder are made up of alternating sugar and phosphate molecules, while the rungs are formed by pairs of nucleotide bases (adenine-thymine and guanine-cytosine). The specific sequence of these bases along the DNA molecule carries genetic information.
it looks like a backwards hand
Palm of the right hand
A loft ladder is typically shorter and designed for accessing smaller spaces like an attic or loft, with a folding design that saves space when not in use. Extension ladders, on the other hand, are longer and can be extended to reach higher places like rooftops or windows, with rungs that are typically wider for more stability when climbing.
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
She was the first scientist to figure out what DNA looks like. It looked like a double helix or twisted ladder,