0
What else can I help you with?
If you un-twist a DNA molecule it looks like a?
ladder.
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What fitness equipment acts like climbing a ladder?
orbitrac‬‏ :)
What laboratory equipment looks like a bowl?
A crucible.
What is rung in plc?
It is a horizontal line of ladder logic.Ladder logic is a language used to program PLC's.It's called Ladder Logic because the programs are formed in the shape of a ladder. Each horizontal line in the program looks like the "rung" of a ladder, which is why they call it Ladder Logic.
How does a werewolves hands looks like?
Like a human hand
What does DNA looks like a?
DNA has a double helix structure, resembling a twisted ladder. The sides of the ladder are made up of alternating sugar and phosphate molecules, while the rungs are formed by pairs of nucleotide bases (adenine-thymine and guanine-cytosine). The specific sequence of these bases along the DNA molecule carries genetic information.
What does qatar map looks like?
Palm of the right hand
What is the Imagery in monkeys paw?
it looks like a backwards hand
What features make a loft ladder different from an extension ladder?
A loft ladder, otherwise known as an attic ladder, is a retractable ladder that is built in to the floor of the attic. An extension ladder is a free standing ladder that can be moved around at will.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
How was Rosalind Franklin involved in discovering the structure of DNA?
She was the first scientist to figure out what DNA looks like. It looked like a double helix or twisted ladder,
