0
What else can I help you with?
If you un-twist a DNA molecule it looks like a?
ladder.
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What fitness equipment acts like climbing a ladder?
orbitrac‬‏ :)
What laboratory equipment looks like a bowl?
A crucible.
What is rung in plc?
It is a horizontal line of ladder logic.Ladder logic is a language used to program PLC's.It's called Ladder Logic because the programs are formed in the shape of a ladder. Each horizontal line in the program looks like the "rung" of a ladder, which is why they call it Ladder Logic.
How does a werewolves hands looks like?
Like a human hand
What does DNA looks like a?
DNA has a double helix structure, resembling a twisted ladder. The sides of the ladder are made up of alternating sugar and phosphate molecules, while the rungs are formed by pairs of nucleotide bases (adenine-thymine and guanine-cytosine). The specific sequence of these bases along the DNA molecule carries genetic information.
What is the Imagery in monkeys paw?
it looks like a backwards hand
What does qatar map looks like?
Palm of the right hand
What features make a loft ladder different from an extension ladder?
A loft ladder, otherwise known as an attic ladder, is a retractable ladder that is built in to the floor of the attic. An extension ladder is a free standing ladder that can be moved around at will.
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
How was Rosalind Franklin involved in discovering the structure of DNA?
She was the first scientist to figure out what DNA looks like. It looked like a double helix or twisted ladder,
