15 = first point in a game of tennis
Wiki User
∙ 14y agoWilliam T. G. Morton died on 1868-07-15.
To replicate the DNA sequence provided (ttcgagacttagtcggatgtgaagtgg tgatt), you would need to use a DNA polymerase enzyme and a primer with a complementary sequence to start the replication process. The primer will bind to the target sequence and direct the addition of nucleotides to form a new DNA strand that is complementary to the original sequence. The result will be two identical DNA strands with the same sequence as the original.
#include<stdio.h> void main() { FILE *fp; char name[20],ch; char *roll; fp=fopen("specifies file path","w"); if(fp!=NULL) { do{ printf("input roll_no"); gets(roll); printf("\ninput student name"); gets(name); fputs(roll,fp); fputs("\t",fp); fputs(name,fp); fputs("\n",fp); printf("you want to continue y/n"); ch=getch(); }while(ch=='y'); } }
A t g t g g a a c c g t g
The DNA sequence provided is: TTCGAGACTTAGTCGGATGTGAAGTGGTGTATT To replicate this DNA sequence, the double-stranded DNA unwinds, and new DNA strands are synthesized using the original strands as templates. Adenine pairs with thymine and cytosine pairs with guanine, following the base pairing rules. This results in two identical DNA molecules, each containing one original strand and one newly synthesized strand.
It's GTTCATCCGA
The complementary DNA strand to "ttgccagc" is "aaggctcg". In complementary base pairing, thymine (T) pairs with adenine (A) and guanine (G) pairs with cytosine (C).
The FP - 2007 was released on: USA: 15 September 2007 (LA Shorts Fest) USA: 12 October 2007 (Kern Projections Film Festival)
The complementary DNA strand to the given sequence would be t c c g a g t c a g a t c g. This follows the base pairing rules where adenine pairs with thymine and guanine pairs with cytosine.
B. G-G-A-T-G-C is the complement strand to C-C-A-T-C-G. The complementary base pairs are as follows: C-G, C-G, A-T, T-A, C-G, G-C.
C-G-A-T-T-A-G-G-C
Before we look at the complimentary mRNA sequence of the given DNA sequence, let us remember that RNA contains uracil (U) in place of Thiamine (T) The querry sequence is: t-a-c-c-t-c-g-c-a-a-c-t So the mRNA sequence would be: A U G G A G C G U U G A