0
What else can I help you with?
Related Questions
What sport does Andy Murry play?
tennis
What sport did Jaden Smith play?
Tae Kwon Doe
What sport does Andy Pettitte play?
Andy Pettitte plays professional baseball. He is currently a member of the New York Yankees.
What sport was Andy six really into as a kid?
when andy was younger, he was really into hockey. its currently his favorite sport. hope this helped ^^
What is Andy Biersack's favorite sport?
Hockey.
Doe Joe Jonas like tennis?
yes its his fav sport
Where does Andy caroll play?
when Andy caroll can play for Liverpool fc
What other sport has Andy Murray played?
football
When was Andy's Play created?
Andy's Play was created on 2010-10-07.
Is Andy Murray a sportsman?
yes he plays tennis which is a sport!
Who is the oldest person to play roblox?
The names of them are: John Doe, Jane Doe, and Administrator. Administrator was an old version of the user: ROBLOX. I believe John & Jane Doe don't play ROBLOX no more
Who was the 2nd to play roblox?
Jane Doe
Trending Questions
Is the river nile in Egypt flat?
Does dying your hair with a bleaching kit damage the hair?
What are the disadvantages of a bar mitzvah?
Emergency number in Austria?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
What was the dillingham act?
What are the top amenities and experiences offered on a Japan sleeper train journey?
What is 12.5 times 6?
What is the manipulative reporting?
Do ducks have nipples?
What two word term for Cowboy western films?
What is the 45th square number?
Who won best direct Oscar for unforgiven?
Does insulation have asbestos?
Who is the actor in the True Credit commercial?
What is the value of a sheridan h series pistol?
What is the distinction between primary and secondary qualities according to John Locke?
How does lignin help xylem vessels to carry out their function?
What are the kinds of history?
What is the melting point of Coca Cola?
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.