answersLogoWhite

0

Who got Sachin's wicket mostly in test cricket?

User Avatar

Anonymous

∙ 13y ago
Updated: 8/19/2019

Waqar Younis got Tendulkar out 15 times.

User Avatar

Wiki User

∙ 13y ago
Copy

What else can I help you with?

Related Questions

Who took sachins last test wicket?

Narsingh Deonarine


Who is highest wicket taker in test cricket?

muralidharan


Who took the Highest Wicket in the First international Test Cricket?

Sharpe


Who is leading wicket taker in a history of test cricket?

muitthaia murlidharan


Who was the first Indian to claim 100 wicket in test cricket?

Subhash Gupte


Who bagged the first ten wicket haul in test cricket?

Anil Kumble


Who is first bowler 10 Wicket hall in Test cricket?

Jim Laker


Who took 100 catches first in test cricket not wicket keeper?

Gary Sobers


Who is the only bowler to take 800 wicket in test cricket history?

Muthaia Muralidharan


Who is leading wicket taker in the history of test cricket?

Type your answer here... shane warne


Who is the first man to taken a10 wicket in test cricket match?

anil kumble.


Who broke kapil dev's record of 434 wicket in test cricket?

Anil Kumble broke Kapil Dev's record of 434 wickets in test cricket. Kumble ended his test career with 619 wickets, making him the highest wicket-taker for India in test matches.

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.