answersLogoWhite

0

When was Al-Qadisiyah FC created?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Al-Qadisiyah FC was created in 1967.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When was FC Cartagena created?

Cartagena FC was created in 1940.


When was FC Vagharshapat created?

FC Vagharshapat was created in 1967.


When was Petrojet FC created?

Petrojet FC was created in 1980.


When was FC Volgograd created?

FC Volgograd was created in 2008.


When was FC Pocheon created?

FC Pocheon was created in 2007.


When was FC Vaduz created?

FC Vaduz was created in 1932.


When was Skonto FC created?

Skonto FC was created in 1991.


When was Elpis FC created?

Elpis FC was created in 1904.


When was FC Mtsapéré created?

FC Mtsapéré was created in 1978.


When was FC Höllviken created?

FC Höllviken was created in 1933.


When was FC Tobol created?

FC Tobol was created in 1967.


When was Girona FC created?

Girona FC was created in 1930.

Trending Questions
How do you break the habit of picking your nose? Is 3 mm bigger then 3m? Where in Seattle can I refill printer cartridges? What is an Example of Legal but unethical behavior? How do you stop squirrels from eating your pumpkins? What former player wore jersey number 11 for the dallas cowboys? How many prokaryotic domains are there? What is the meaning of 'Je Vous Aime'? What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg? How do you judge the form of address to use with your clients? How long does it take for carmex to heal a gunshot wound? When did the government start to become deeply involved in business for the first time? Who is always happy when things go wrong? What time did Mount Tambora happen? What is the song hurricane by 30 seconds to mars about? What are the surnames on Friends tv show? What is the name of the lead singer from Down With Webster? Is buying stock in dodge motor company a good investment? Is valentino lanus married with jacqualine bracamontes? Is the Acer AS5742-6440 laptop good?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2025 Answers.com | Lunias Media Inc. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.