0
What else can I help you with?
Related Questions
What is better Nerf deploy or Nerf spectre?
deploy
Where to buy the Nerf deploy?
You can get it on youtube. The Nerf deploy is said to come out in May 2010.
What Nerf are coming out in 2010?
Nerf cs6 deploy
Is the Nerf deploy better than the Nerf longstrike?
No
Should you get the Nerf deploy or Nerf barricade?
i would recommend the deploy but if you like submachine guns i would go with the barricade
When does the Nerf deploy come to the UK?
The Nerf deploy is already out! You can buy them in Argos, Tescos, toys r us and places like that.
How much money dus the Nerf deploy cs-6 cost?
the Nerf deploy is about 20,24,25 dollars in qeensland at hasbro.com
Where can you buy the Nerf deploy?
America
Can you buy a Nerf deploy in Australia?
yes
When will the Nerf deploy come out in Australia?
tomorrow
How far does the Nerf deploy shoot?
The Deploy can shoot up to 40 feet if you are lucky.
What is the name of the Nerf gun that switches from a case to a gun?
It is called the Nerf Deploy CS-6.
Trending Questions
How long would it take for 10 ml of water to evaporate?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Who was the first marine recruiter?
When was Juan Uruchurtu born?
Who played Shaka in Shaka Zulu?
How can I create a smooth and professional slide transition in After Effects?
What is the cubic root of 648?
Do kenyan passports have a passport book?
What is the definition of persevere?
Is zinc alloy jewelry safe to wear?
Prior to the Renaissance the human body was seen as-?
Who are malika and khadija haqq parents?
A car rental company charges 21 dollars per day and 10 cents per mile. If a car was rented for 2 days how far was it driven if the total bill came to 220 dollars?
What are parts of Rotating anode dual focus x-ray tube?
How does a society become a civilization?
What is the name of the badminton ''ball''?
Why does the nitrogen level in the atmosphere is higher than the oxygen level?
What president got shot but didn't die instantly?
What type of oil for 2002 Taurus?
What are the release dates for How Do They Do It - 2006 Manufacture Propellers Create Intelligent Cars Turn Metal Into Magnets 6-15?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.