answersLogoWhite

0

When and where did baseball player Jimmy Grant die?

User Avatar

Anonymous

∙ 11y ago
Updated: 8/21/2019

Jimmy Grant died July 8, 1970, in Rochester, MN, USA.

User Avatar

Wiki User

∙ 11y ago
Copy

What else can I help you with?

Related Questions

When did Jimmy Grant die?

Jimmy Grant died on 1970-07-08.


When did baseball player Eddie Grant die?

Eddie Grant died October 5, 1918.


When and where did baseball player Jimmy Mathison die?

Jimmy Mathison died July 4, 1911, in Baltimore, MD, USA.


When and where did baseball player Jimmy McAleer die?

Jimmy McAleer died April 29, 1931, in Youngstown, OH, USA.


When and where did baseball player Jimmy McMath die?

Jimmy McMath died July 20, 2010, in Meadville, MS, USA.


When and where did baseball player Jimmy Moore die?

Jimmy Moore died March 7, 1986, in Memphis, TN, USA.


When and where did baseball player Jimmy Outlaw die?

Jimmy Outlaw died April 9, 2006, in Jackson, AL, USA.


When and where did baseball player Jimmy Pattison die?

Jimmy Pattison died February 22, 1991, in Melbourne, FL, USA.


When and where did baseball player Jimmy Peoples die?

Jimmy Peoples died August 29, 1920, in Detroit, MI, USA.


When and where did baseball player Jimmy Pofahl die?

Jimmy Pofahl died September 14, 1984, in Owatonna, MN, USA.


When and where did baseball player Jimmy Ripple die?

Jimmy Ripple died July 16, 1959, in Greensburg, PA, USA.


When and where did baseball player Jimmy Ryan die?

Jimmy Ryan died October 29, 1923, in Chicago, IL, USA.

Trending Questions
Why can't regular pentagons tesselate? What is the scientific name for sensitive skin? What are synonyms for forefront? When was Luke called by Jesus? What are some common communication challenges faced by individuals with hyperverbal autism? What is ASDA's equal opportunities policies? Which is farther south Brownsville in the US or the city of chihuahua? When did Abraham Lincoln went to see the Antietam battlefield? What do you call a frozen pickle? Pokemon Platinum game id code? Is Jamaica in Brazil? Does cooper die in One Tree Hill? What kind of damage did hurrricane earl do? What is a peripheral graphic array? How many Buddy Holly records have been sold? Who is lulia in to kill a mockingbird? Do 8 and 16 hour security guard training certificates in NYC lose merit after time or anything else? What has the author June Vendall Clark written? What weapons does the 82nd airborne division use? What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?

Resources

Leaderboard All Tags Unanswered

Top Categories

Algebra Chemistry Biology World History English Language Arts Psychology Computer Science Economics

Product

Community Guidelines Honor Code Flashcard Maker Study Guides Math Solver FAQ

Company

About Us Contact Us Terms of Service Privacy Policy Disclaimer Cookie Policy IP Issues
Answers Logo
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.