0
Daren Bates plays Line Back for the St. Louis Rams.
What else can I help you with?
Related Questions
What NFL team does Daren Bates play for?
Daren Bates plays for the St. Louis Rams.
What college did NFL player Daren Bates play for?
NFL player Daren Bates played for Auburn.
How tall is Daren Bates?
NFL player Daren Bates is 5'-11''.
What is Daren Bates's number on the St. Louis Rams?
Daren Bates is number 53 on the St. Louis Rams.
How much does NFL player Daren Bates weigh?
NFL player Daren Bates weighs 225 pounds.
How old is Daren Bates?
As of the end of the 2013-2014 NFL season Daren Bates is 23 years old.
What position does Darren Bates play?
Safety/Linebacker
What position does Phil Bates play?
Phil Bates plays Wide Receiver for the Seattle Seahawks.
What sport does daren ganga play?
He plays cricket
What is the birth name of Daren Kelly?
Daren Kelly's birth name is Daren Lee Kelly.
What NFL team does Phil Bates play for?
Phil Bates plays for the Seattle Seahawks.
How tall is Daren Jackson?
Daren Jackson is 6'.
Trending Questions
Where can someone get document scanning in the UK?
What is music played by a small group of instruments?
What is the 661 F Supp 155 court case?
Full Form of RTI?
What is a powerful communications and scheduling program that helps you communicate with others among other things?
What is the definition of stature?
What is greater 08 or 05?
What is the meaning of online examination?
What did the Federalists agree to add to the Constitution after its ratification?
Is Samantha a proper noun?
Why do you think Marcus garvey is the most infuential or seccessful?
When is ava szymanski birth date?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
When did baseball player Josh Donaldson play?
What is 75th birthday anniversary called?
How much money bull rider make?
How do you use countless in a sentence?
Does an octopus live on the farm?
What are raw values?
When Cortes and the conquistadors arrived in Mexico what did the Aztecs do?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.