0
A goes to U and G goes to C. DNA its A=T G=C.
What else can I help you with?
A special enzyne scans the DNA helix in search of improper nitrogen base pairings how would the enzyne be able to detect incorrect nitrogen base pairings?
stupid science stuff
What enzyme proof reads DNA base pairings?
DNA polymerase
Can you match the base pairings 5'aggaaaatgaagtcaagaaatgg3' 3'--------------------5'?
tccttttacttcagttctttacc
Only two combinations of base pairings are possible for the rungs list them?
The two combinations of base pairings possible in DNA are adenine (A) with thymine (T) and cytosine (C) with guanine (G). These pairings occur due to the specific hydrogen bonding patterns between the bases, where A pairs with T through two hydrogen bonds and C pairs with G through three hydrogen bonds. This complementary base pairing is fundamental to the structure of DNA and its replication.
The strict arrangement of base-pairings in the double helix results in two strands of nucleotides that are?
complimentary to each other
What are the base pairings for DNA and RNA?
DNA has A-T and C-G while RNA has A-U and C-G
What are the complementary base pairings in DNA and how do they contribute to the structure and function of the molecule?
The complementary base pairings in DNA are adenine (A) pairing with thymine (T), and cytosine (C) pairing with guanine (G). These pairings contribute to the structure and function of DNA by ensuring the accurate replication of genetic information during cell division. The specific pairing of these bases allows for the double helix structure of DNA to form, which is essential for storing and transmitting genetic information.
What does Rival Pairings mean?
Rival pairings refer to the relationship between a villain and a hero in literature.
What are the release dates for Pairings - 2012?
Pairings - 2012 was released on: USA: 9 October 2012 (internet)
What are the release dates for Pairings with Andrea - 2005?
Pairings with Andrea - 2005 was released on: USA: 2 October 2005
What are good pairings for hidan?
Konan???
What are the release dates for Pairings with Andrea - 2005 All That Jazz?
Pairings with Andrea - 2005 All That Jazz was released on: USA: 2006
