answersLogoWhite

0

A goes to U and G goes to C. DNA its A=T G=C.

User Avatar

Kara White

Lvl 10
4y ago

What else can I help you with?

Related Questions

A special enzyne scans the DNA helix in search of improper nitrogen base pairings how would the enzyne be able to detect incorrect nitrogen base pairings?

stupid science stuff


What enzyme proof reads DNA base pairings?

DNA polymerase


Can you match the base pairings 5'aggaaaatgaagtcaagaaatgg3' 3'--------------------5'?

tccttttacttcagttctttacc


Only two combinations of base pairings are possible for the rungs list them?

The two combinations of base pairings possible in DNA are adenine (A) with thymine (T) and cytosine (C) with guanine (G). These pairings occur due to the specific hydrogen bonding patterns between the bases, where A pairs with T through two hydrogen bonds and C pairs with G through three hydrogen bonds. This complementary base pairing is fundamental to the structure of DNA and its replication.


The strict arrangement of base-pairings in the double helix results in two strands of nucleotides that are?

complimentary to each other


What are the base pairings for DNA and RNA?

DNA has A-T and C-G while RNA has A-U and C-G


What are the complementary base pairings in DNA and how do they contribute to the structure and function of the molecule?

The complementary base pairings in DNA are adenine (A) pairing with thymine (T), and cytosine (C) pairing with guanine (G). These pairings contribute to the structure and function of DNA by ensuring the accurate replication of genetic information during cell division. The specific pairing of these bases allows for the double helix structure of DNA to form, which is essential for storing and transmitting genetic information.


What is the only two combinations of base pairings are possible for the rungs. what are these molecule combination or pairs?

In DNA, the only two combinations of base pairings possible for the rungs of the double helix are adenine (A) pairing with thymine (T) and cytosine (C) pairing with guanine (G). This complementary pairing is crucial for the stability of the DNA structure and for accurate replication during cell division.


What does Rival Pairings mean?

Rival pairings refer to the relationship between a villain and a hero in literature.


What are the release dates for Pairings - 2012?

Pairings - 2012 was released on: USA: 9 October 2012 (internet)


What is the rule for dividing powers to the same base?

When dividing powers with the same base, you subtract the exponents. The rule can be expressed as ( a^m \div a^n = a^{m-n} ), where ( a ) is the base and ( m ) and ( n ) are the exponents. This rule applies as long as the base ( a ) is not zero.


Which base pairings normally occur during DNA replication?

During DNA replication, adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). This base pairing is facilitated by hydrogen bonds, with A forming two hydrogen bonds with T and C forming three hydrogen bonds with G. These specific pairings ensure accurate copying of the genetic information during the replication process.