0
What is the name of that gym equipment that looks like a hand ladder to make pull ups?
Wiki User
∙ 16y ago
A framed set of round wooden rungs hung on a wall goes by the name of gynamistic wall bars or stahl bars and is used in gynamistic stretching and training exercises. I was looking to purchase one as it has many possible uses as a prop for yoga practice.
Wiki User
∙ 16y ago
Add your answer:
Earn +20 pts
Is a gene shaped like a spiral ladder?
Yes, chromosomes have Watson and Crick model. which looks like a spiral ladder.
If you un-twist a DNA molecule it looks like a?
ladder.
What does DNA looks like a?
it sorta looks like two trees entwined together wit the branches fused together
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What fitness equipment acts like climbing a ladder?
orbitrac‬‏ :)
What laboratory equipment looks like a bowl?
A crucible.
What is rung in plc?
It is a horizontal line of ladder logic.Ladder logic is a language used to program PLC's.It's called Ladder Logic because the programs are formed in the shape of a ladder. Each horizontal line in the program looks like the "rung" of a ladder, which is why they call it Ladder Logic.
How does a werewolves hands looks like?
Like a human hand
What does the DNA double helix look like?
Think of it as a ladder, being twisted.
What does qatar map looks like?
Palm of the right hand
What is the Imagery in monkeys paw?
it looks like a backwards hand
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
