0
What is the name of that gym equipment that looks like a hand ladder to make pull ups?
Wiki User
∙ 16y ago
A framed set of round wooden rungs hung on a wall goes by the name of gynamistic wall bars or stahl bars and is used in gynamistic stretching and training exercises. I was looking to purchase one as it has many possible uses as a prop for yoga practice.
Wiki User
∙ 16y ago
Add your answer:
Earn +20 pts
If you un-twist a DNA molecule it looks like a?
ladder.
Why the DNA molecule is compared with a twisted ladder?
the whole DNA strand looks like a twisted ladder. the molecules are on the strand.
What fitness equipment acts like climbing a ladder?
orbitrac‬‏ :)
What laboratory equipment looks like a bowl?
A crucible.
What is rung in plc?
It is a horizontal line of ladder logic.Ladder logic is a language used to program PLC's.It's called Ladder Logic because the programs are formed in the shape of a ladder. Each horizontal line in the program looks like the "rung" of a ladder, which is why they call it Ladder Logic.
What does DNA looks like a?
DNA has a double helix structure, resembling a twisted ladder. The sides of the ladder are made up of alternating sugar and phosphate molecules, while the rungs are formed by pairs of nucleotide bases (adenine-thymine and guanine-cytosine). The specific sequence of these bases along the DNA molecule carries genetic information.
How does a werewolves hands looks like?
Like a human hand
What does a DNA nucleotide look like?
TCCAAGAACCTACATGTTCGCGTGTTCAGCGTCCATTTCAGTATTTAGCATAAATTTGAAGAGCCGAATGGCAGTTTTGGGAGGGACACGTTGTTTTAAAAGAAGCCTTCACGAAATTGTGACCGGTCTGGACTGAAAGTACCACGGATATCTAGCAGAAAACTAAGATTCCGCCAACCTTCTCTGTTTGCCTATGACCAACAGCATCTCAGGGT
What features make a loft ladder different from an extension ladder?
A loft ladder is typically shorter and designed for accessing smaller spaces like an attic or loft, with a folding design that saves space when not in use. Extension ladders, on the other hand, are longer and can be extended to reach higher places like rooftops or windows, with rungs that are typically wider for more stability when climbing.
What does qatar map looks like?
Palm of the right hand
What is the Imagery in monkeys paw?
it looks like a backwards hand
How was Rosalind Franklin involved in discovering the structure of DNA?
She was the first scientist to figure out what DNA looks like. It looked like a double helix or twisted ladder,
