0
Robyn Regehr plays for the Los Angeles Kings.
What else can I help you with?
Related Questions
Does Robyn Regehr shoot right or left?
NHL player Robyn Regehr shoots left.
How much does Robyn Regehr weigh?
NHL player Robyn Regehr weighs 225 pounds.
How many Mexicans play NHL?
None, but Robyn Regehr was born in Brazil!
How do you be in the nhl?
You get drafted by game scouts. They give you a chance to play on their AHL team and if they like what they see, you will soon get a chance to play in their nhl team.
Who does Scott Hartnell Play for in the NHL?
the worst team in the NHL, the garbage flyers, who suck
What NHL team plays in Washington?
The Washington Capitals play in Washington DC. There is no NHL team that plays in the state of Washington.
On nhl 07 how do you play your created team?
you cant !
Who is the NHL team that the Rockford Icehogs play for?
They are a farm team for the Chicago Blackhawks.
What is Edmonton's NHL team?
Edmonton's NHL team is called the Oilers - formed in November 1971, they play in the Northwest Division of the Western Conference.Â
What NHL team does Mike Modano play for?
Dallas Stars
What sports team play in Nashville?
Nashville Predators(NHL)
What NHL team did Alex Trebek play for?
New jersey
Trending Questions
How would you define constrictive pericarditis?
Were the medes allies of the Assyrians?
Can you install a flash player on your Wii?
What is 8Cr13MoV stainless steel blades?
What is the basic SI unit of volume called?
What definition of abnormal behavior is Bill using?
What creek or stream is between Creek Rd and S Water in buffalo NY?
Do girls like men in thong underwear?
How do you draw a Halo 3 warthog step by step?
Blood leaves through the semilunar valve and goes into the?
Danger danger lies ahead skirt it with a delicate thread do not stick your chin out or you'll regret it no doubt?
How many places in philippines?
What does cells of eurayotes take place in?
What math classes do you have to take to get into Yale?
What is textile?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
What was the main reason that American colonists opposed the stamp act?
Who was Edwin Holmes and Thomas Watson?
What drink is made in England?
How do you do a flipnote on computer?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.