0
Still curious? Ask our experts.
Chat with our AI personalities
JordanLooking for a career mentor? I've seen my fair share of shake-ups.
Chat with Jordan
BlakeAs your older brother, I've been where you are—maybe not exactly, but close enough.
Chat with Blake
SteveKnowledge is a journey, you know? We'll get there.
Chat with SteveAdd your answer:
Earn +20 ptsQ: Was the German Bundesliga in 1983?
Write your answer...
Submit
Still have questions?
Trending Questions
Where is the Toa Baja Public Library - Jaime Fonalledas - in Toa Baja located?
What concerns did the Filipinos have regarding the bell act?
How do DNA probes work to identify specific genetic sequences?
Why are water waste treatment facilities not treating pharmaceutical pollutants?
What is Malaysias climate?
What is the DNA sequence for the corresponding strand aggccattagccctattcgggtataaatgg?
Ano ang kahalagahan ng heograpiya?
Can two people play mahjong together"?
What were the questions Noah got asked in the interview in the book Flush?
What are the functions of media in a democratic society?
What was the dark green colour called that vauxhall used on the frontera?
What is the opposite of liar?
What do you do if your wife cheats on you in long distance relationship?
What direction does the eagle on the capitol building of Mississippi point?
What veins are used in coronary bypass surgery?
When did Sven Aage Dabelsteen die?
What is the scientific name of pawikan?
Are ll cool j and Nelly related?
Are Vera Bradley bags available on eBay?
What caused hurricane Rita?
Copyright ©2025 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.