0
What else can I help you with?
Related Questions
Is Vicsera actually Big Daddy V?
Big Daddy V and Viscera are the same person. Viscera no longer exists. Say Hello! to Big Daddy V!
Is Big Daddy V alive?
Yes, Big Daddy V is alive.
What day Is Big Daddy V Is dead?
Big Daddy V is still alive.
What happened to big daddy v when he vs the undertaker?
Big Daddy V tapped out via hells gate. There was a bunch of blood coming out of Big Daddy V's mouth.
What happend to Big Daddy V?
Big Daddy V was in a injury during the triangle choke.
What is Big Daddy V's birthday?
Big Daddy V was born on February 14, 1972.
Is tna interested in big daddy v?
big daddy v's time in wrestling is done he is retired
Is Big Daddy V Viscera?
Yes, the V means Viscera and he is also Mabel.
Will Big Daddy V be in Smackdown vs Raw 2010?
NO i have it shannon morre isn't in it big daddy v isn't in it
How much does big show and big daddy v weigh combined?
Big Show: 441 lbsBig Daddy V: + 485 lbsTotal: 926 lbs
What is Big Daddy V's real name?
Big Daddy V's real name is Nelson Frazier, Jr.
Where has Big Daddy V gone?
Big Daddy V or Viscera (other gimmick) is exactly 6 foot 8.5 inches tall.
Trending Questions
When cranking a car it wont start but antifreeze is pouring out of the blockwhy?
What number is the next logical number 414111431141?
What is the maximum effective range of the M500?
Why is helium lighter than CO2?
How do you spell presentor?
Is a 12 year old too young for a hickey?
When will the under construction site on moshinmonsters open up?
Which jet company offers an option for you to charter a private jet?
Has any MLB team ever had 4 players with 30 HR and 100 RBI in one season?
In what ways has mining affected Africa?
How much does a stay at Galley Bay Resorts cost?
Is nickel bromide insoluble in water?
Happy new year translate to Azerbaijani?
What was the compromise that allowed California to be admitted to union?
What is the complementary strand of DNA AATAGTACGCGAGTCGTGATGAAATTCT?
Is a person with blood type O a universal donor?
What are the three zones of the ocean?
How do I access Kindle download?
Where is the Output Shaft Speed sensor on a 2001 Ford escape?
Comparison between the electronegativity of chlorine and nitrogen?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.