0
What else can I help you with?
Related Questions
When was Keylor Navas born?
Keylor Navas was born on 1986-12-15.
What position does Keylor Navas play?
Keylor Navas plays as a Goal Keeper for Costa Rica.
For what club does Keylor Navas play?
As of June 2014, Keylor Navas plays for Levante, a club in Spain.
For what country did Keylor Navas play in the 2014 FIFA World Cup?
Keylor Navas played for Costa Rica in the 2014 FIFA World Cup.
What number did Keylor Navas wear in the 2014 FIFA World Cup?
Keylor Navas wore jersey number 1 in the 2014 FIFA World Cup.
How many games had Keylor Navas played with Costa Rica before the 2014 FIFA World Cup?
Keylor Navas had played 53 times for Costa Rica before the 2014 FIFA World Cup.
Who won the Man of the Match award in the Costa Rica vs. England group stage match in the 2014 FIFA World Cup?
Keylor Navas (Costa Rica) was designated the Man of the Match.
How old is Jesús Navas?
Spanish footballer Jesús Navas is 32 years old (birthdate: November 21, 1985).
How old is Brittany navas?
16 yrs old
How old is José Eduardo González Navas?
José Eduardo González Navas is 60 years old (birthdate: April 14, 1951).
When was Erika Navas born?
Erika Navas was born in 1959, in Mexico.
When was Gonzalo Navas born?
Gonzalo Navas was born in 1979, in Spain.
Trending Questions
Who is the developer of Mini Ninjas?
Where can you go to read The Battle of the Labyrinth online?
How beneficial you think it is to group students according to their level of ability?
How do you make a fake lighter out of paper?
What is the complementary sequence for atgcccgggtgtcgtagttga?
What is the frequency of telephone line?
What happens between a radius and a tangent in a circle?
How much does a 16 GB ipod nano cost?
Importance of school laboratories?
How many volumes are there in each book of Avatar the Last Airbender book?
What are the 6 major results of the Great Awakening?
Should the timing chain on a 2001 Chevy Tahoe 5.3 liter v8 be changed?
Where is the piston return spring located on a 5.7 2008 dodge charger?
How can molten NaCl be electrolyzed to form pure Na and pure Cl?
My mom sleeps in her lift chair - refusing to sleep in a bed any more. She is 85. She is incontinent and has trouble standing and walking.?
Which animal has the most complex excretory organ?
What does the total number of allowances mean on the w 4 form?
What physical property is responsible for earths layers forming in the order they did?
Are cameras allowed at Darien Lake concerts?
Who is the two detectives in the tintin books?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.