Tags
Football - Soccer
American Soccer
Subjects
Animals & Plants
Arts & Entertainment
Auto
Beauty & Health
Books and Literature
Business
Electronics
Engineering & Technology
Food & Drink
History
Hobbies
Jobs & Education
Law & Government
Math
People & Society
Science
Social Studies
Sports
Travel & Places
Create
0
Log in
How many players were in the MLS in 2005?
Updated: 8/20/2019
Wiki User
∙
12y ago
Study now
See answer (1)
Best Answer
Copy
About 425
Wiki User
∙
12y ago
This answer is:
👍
Helpful (0)
👎
Not Helpful (0)
Add a Comment
Add your answer:
Earn +20 pts
Q: How many players were in the MLS in 2005?
Write your answer...
Submit
Still have questions?
Find more answers
Ask your question
Related questions
How many players were in the MLS in 2000?
400
How many players were in the MLS in 2004?
About 420
How many players were in the MLS in 2010?
At about 490
How many players were in the MLS in 2011?
At about 500
How many Canadian players are in the MLS?
16
How many players were in the MLS in 2001?
Over 400
How many players were in the MLS in 2003?
Over 400
How many players were in the MLS in 2007?
Over 425
How many players were in the MLS in 2008?
Over 450
How many players were in the MLS in 2009?
Over 450
How many players were in the MLS in 2002?
Over 400
How many players were in the MLS in 2006?
Over 425
Trending Questions
A light wave passes at an angle through a chunk of glass into the air. What happens to it in respect to the normal Why?
What is the steamboat era?
How much 360000 joules in kilowatt?
How many miles per hour can a sloth run?
What are the codons and anticodons for the sequence auguucguuaacgaccaaauuuaa?
What do lions not eat?
What are some terms used in plumbing?
What do you call the amount of time it takes for a planet to orbit the sun?
Why does CCl4 does not conduct electricity?
How long does it take for the bone to grow back after having surgery to move the jaw?
How do you open the gates in canis canem edit?
Does a spring scale measure weight?
How long do solar cells last?
How is the energy of an em wave determined?
Which is more reactive barium or cesium?
What type of rock is green grey in pacific northwest?
How do you keep your urinary system healthy?
Where do hurricanes occur more frequently?
What is partial vaporization?
What two properties determine the density of sea water?
Previously Viewed
How many players were in the MLS in 2005?