0
What else can I help you with?
Related Questions
When has the Olympic Games not gone ahead?
In both the world wars
How long have the Olympic gone on for?
Over 100000000 years
How long has the olympic flame been burning?
The flame hasn't gone out since 776BC
What was in the pentathlon in the ancient olympic games?
sprinting, long-jumping, javelin, discuss and wrestling were in the Pentathlon in the Ancient Olympic games
How long were the first olympic games?
4 days
When did long jump become a Olympic event?
since the first international Olympic games in 1896 :)
How long has Badminton been in the Summer Olympic Games?
Badminton became an Olympic sport in 1992.
How long is a London olympic pool?
In the London 2012 Olympic Games the pool is 50 m length.
How long has the olympic games been going on?
About 17 years
How long is the olympic games?
27 July - 12 August
How long did the ancient olympic games last?
7 days
How long have the olympic games been going on?
17 YEARS
Trending Questions
How much do drinking fountains cost?
Does SpongeBob like squidward?
How can you get your repossessed boat back?
Can cattle mineral hurt a horse?
Which method of organization organizes your essay according to time?
How many horns can a chameleon have?
Make one bird name which start with urdu word WAO?
Where can you get a good tf2 furry spray?
Is there any grants from the government when arson occurs?
How much does it cost for a new jeep canvas?
Why did vinegar and salt solution clean the pennies?
What is the correct complementary DNA starnd for gacatcgttgactacggctgatc?
What was Sir Isaac Newton weakness?
Dixie are below the Mason-Dixie line?
Competence used in a sentence?
How do you fix a window that will not stay up on a 2002 Jeep Grand Cherokee?
Is Iraq located in the middle east of Asia?
In-line vs external image?
What is the English translation for abajo una hay calle?
What are forms of cell regulation?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.