0
What else can I help you with?
Related Questions
What does ripstick G stand for?
Ripstick Glide
Is it ribstick or ripstick?
I think I saw one in WAL-MART.
What is better ripstik or skateboard?
Ripstick is the best.
Does Justin Bieber ripstick?
Yes, he does! I saw a pic of him trying out a ripstick as the before and he was, like, falling of the ripstick and then there was an after and he was riding it perfectly. So practically, Yes!
“Can I ripstick?
Yes
Can go faster skateboard or ripstick?
depends on the type if its a walmart board then its ripstick a real board then skateboard
What is different about ripsticks and skateboards?
the skateboard is cheaper and is better for balance and the ripstick is the opposite of that
What is the difference between a ripstick DLX and a ripstick G do they both have the spinning grind bar in the middle or is the DLX grind bar fixed like the original ripstick?
the dlx is made of carbon fiber
What do you think is better for Christmas the wave or a razor ripstick?
I think a ripstick is sooooo much better in my opinion because I have no idea what a wave is and i finally learned how to ride a ripstick an now i REALLY want one!
What store can you buy a ripstick in Scotland?
you can buy a ripstick at "toys r us" in Scotland , that'swhere i got mine
Where can you get a ripstick?
Wal-Mart
When was the ripstick made?
2006
Trending Questions
Is jade dynasty better than RuneScape?
What does ursinologist use?
What is the sequence that is complementary to this ccctatcatcttgttacgacacggagtcatacgaggaatatggttaatctcttgataacgtta?
How are the grade equivalent score interpreted?
What is the need to dispose of waste materials and consumables?
How tall is Greg Camilleri?
What is the weight of A5 paper?
What are advantages and disadvantages of a proscenium stage?
What type of credit check, hard or soft, will be conducted during the application process?
What is tattooed on Popeye's bulging forearms?
Did Andrew Carnige use horizontal or vertical consolidation to gain control of the steel industry?
How has tried The Idiot Proof Diet generator diet?
Is smelly fish bad?
What type of polygon carries a total angle of 1800 degrees?
How many 5ps go into 3 ponds?
What animals live in lake okeechobee?
What is the area of Tronzano Lago Maggiore?
When did the Spamalot musical comedy first perform?
Where could one get free advice from a debt consolidation company?
What is the reasons for global spatial distribution of deserts?
Copyright ©2026 Infospace Holdings LLC, A System1 Company. All Rights Reserved. The material on this site can not be reproduced, distributed, transmitted, cached or otherwise used, except with prior written permission of Answers.