answersLogoWhite

0

15 is the FP in a G of T?

User Avatar

Wiki User

โˆ™ 2009-11-26 22:41:06

Best Answer

15 = first point in a game of tennis

User Avatar

Wiki User

โˆ™ 2009-11-26 22:41:06
This answer is:
๐Ÿ™
0
๐Ÿคจ
0
๐Ÿ˜ฎ
0
User Avatar
Study guides

Sports

21 cards

What happens if carbon dioxide levels in the blood are too low

Which sport combined the games of handball and squash

What type of surface is the All-England championships at Wimbledon played on

Which of these sports features a competition known as the Grand Slam

โžก๏ธ
See all cards
โ˜†โ˜…โ˜†โ˜…โ˜†โ˜…โ˜†โ˜…โ˜†โ˜…
No Reviews

Add your answer:

Earn +20 pts
Q: 15 is the FP in a G of T?
Write your answer...
Submit
Still have questions?
magnify glass
imp
Related questions

When did William T. G. Morton die?

William T. G. Morton died on 1868-07-15.


How do you replicate t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?

The bases needed to replicate the bases in the question is aagctctgaatcagcctacacttcaccactaa.


C program to create symbol table?

#include #include #include #include void main() { int i,j,k,n,add=0,size; char c,in[20],temp[20],val[20],var[20]; FILE*fp; clrscr(); fp=fopen("input.c","r"); c=getc(fp); printf('\n THE INPUT FILE IS:") while(!feof(fp)) { { printf("%c",c); c=getc(fp); } fclose(fp); printf("\n**************symbol table**************"); printf("\n DAta type\tName\tNo.of Elements\tSize\tAddress"); printf("************************************"); while(!feof(fp)) { if(isalpha(c)) { i=0; do { temp[i==]=c c=getc(fp); }while(isalpha(c)); temp[i]='\0'; if(strcmp("int",temp)==0) { strcpy(val," "); strcpy(in," "); strcpy(var," "); while(c!=';') { strcpy(val," "); c=getc(fp); i=0; do { var[i++]=c; c=getc(fp); }while(isalpha(c)); var[i]='\0'; if(c=='[') { i=0; c=getc(fp); strcpy(in," ") do { in[i++]=c; c=getc(fp); k=atoi(in); size=size*k; } else { strcpy(in,'1'); size=2; } if(c=='=') c=getc(fp); i=0; do { val[i++]=c; c=getc(fp); }while(c!=','&&c!=';') val[i]='\0'; } printf("\n%s\t\t%s\t%s\t\t%s\t%dBytes\t%d",temp,var,val,in,size,add); add=add+size; } } } else c=getc(fp); } getch(); }


What is the amino acid sequence for t a c a c c t t g g c g a c g a c t?

A t g t g g a a c c g t g


What is the complimentary base sequence for this DNA segment a-a-t-g-t-t-a-t-ac-a-a-g-g-c-a-t?

a-a-t-g-t-t-a-t-ac-a-a-g-g-c-a-t- t-t-a-c-a-a-t-a-tg-t-t-c-c-g-t-a


What is the DNA replacation for t t c g a g a c t t a g t c g g a t g t g a a g t g g t g a t t?

a a g c t c t g a a t c a g c c t a c a c t t c a c c a c t a a.T, which stands for Thymine, only "goes" with A (Adanine). C, which stands for cytosine, only "goes" with G (Guanine). Therefore, the replication for it would be reversed.


What is the mRNA sequence of t a c a t c t t g g c g a c g a c t?

The mRNA sequence of t-a-c-a-t-c-t-t-g-g-c-g-a-c-g-a-c-t is UTGTUGUUCCGCTGCTGU.


What is the mRNA sequence of T A C A C C T T G G C G A C G A C T?

The mRNA sequence of t-a-c-a-t-c-t-t-g-g-c-g-a-c-g-a-c-t is UTGTUGUUCCGCTGCTGU.


A C program to store students record in a file?

#include<stdio.h> void main() { FILE *fp; char name[20],ch; char *roll; fp=fopen("specifies file path","w"); if(fp!=NULL) { do{ printf("input roll_no"); gets(roll); printf("\ninput student name"); gets(name); fputs(roll,fp); fputs("\t",fp); fputs(name,fp); fputs("\n",fp); printf("you want to continue y/n"); ch=getch(); }while(ch=='y'); } }


What is the mRNA sequence for t a c t a g a a g t t t t a c c t t a c t?

the mRNA sequence is A U G A U C U U C A A A A T G G A A U G A


What is the complimentary pair of DNA strand a c t g a t g c g a t c t a g c t a t t c c g?

TGACTCGCTAGATCGATAAGGC


What is the complementary DNA for a t g g c t t a?

T a c c g a a t


What is the studying process of how DNA is copied call?

DNA Replication. A C T A G G T G A T C C A C T A G G T G A T C C


What nucleotide sequence would represent the complimentary DNA strand to the following a g g c t c a g t c t a g c?

t c c g a g t c a g a t c g


What is the complementary DNA bases for AGAGGAGTCACCAAAATT?

t-c-t-c-c-t-a-g-t-g-g-t-t-t-t-a-a


If the DNA molecule is a-t-t-c-g-a-c-c-t-a-c-g What is the complementary strand of DNA produced?

3' T-A-A-G-C-T-G-G-A-T-G-C 5'


What is a complementary DNA strand using a t t g c c a g c?

t a a c g g t c g


Which one of the following strands of DNA is the compement strand to C-C-A-T-C-G A. G-G-T-A-G-C C. A-A-C-G-A-T B. G-G-A-T-G-C D. T-T-G-C-T-A?

Remember this phrase:{ Good Couples are Always Together}. C becomes G and A becomes T.


What is the matched DNA sequence for g-a-c-g-t-a-c-t-g-g-a-t?

Well...A pairs with T and G pairs with C. So the matching sequence would probably be... C-T-G-C-A-T-G-A-C-C-T-A :)


If a strand of DNA is read a-t-t-c-g-g-a then what would be its complimentary strand?

t-a-a-g-g-c-t.


What would the complementary strand of DNA be for the sequence of bases below C T T A G G C T T A C C A?

The complement of A is T, and the complement of C is G. Thus, the complementary strand would be: G A A T C C G A A T G G T


What will be produced by DNA replication if the DNA molecule is a-t-t-c-g-g-a-a-t-g-g-a-a-t-c-c-c-g?

TAAGCCTTACCTTAGGGC


What is the complementary sequence for T-C-A-A-G-C?

A-G-T-T-C-G


What is the nitrogenous base for c c a g t a g t t?

C pairs with G and A pairs with T. So, G G T C A T C A A. If that's not what you want, I'm sorry.


What would the complementary strand of DNA be for c t t a g g c t t a c c a?

The complementary base of A is T, and the complementary base of G is C. So if there is an T the complementary would be A, and if there is a C the complementary would be a G and so on. Therefore the complementary strand would be: G A A T C C G A A T G G T.